Home

Monument Nursery school cinema mouse beta actin primer Outdated Deformation violation

IFN-Lambda (IFN-λ) Is Expressed in a Tissue-Dependent Fashion and Primarily Acts on Epithelial Cells In Vivo | PLOS Pathogens
IFN-Lambda (IFN-λ) Is Expressed in a Tissue-Dependent Fashion and Primarily Acts on Epithelial Cells In Vivo | PLOS Pathogens

Sequences of the primers used in real-time PCR of the mouse tissue. | Download Table
Sequences of the primers used in real-time PCR of the mouse tissue. | Download Table

THE™ beta Actin Antibody [HRP], mAb, Mouse - GenScript
THE™ beta Actin Antibody [HRP], mAb, Mouse - GenScript

IJMS | Free Full-Text | Functional Analysis of the Promoter Region of Japanese Flounder (Paralichthys olivaceus) β-actin Gene: A Useful Tool for Gene Research in Marine Fish
IJMS | Free Full-Text | Functional Analysis of the Promoter Region of Japanese Flounder (Paralichthys olivaceus) β-actin Gene: A Useful Tool for Gene Research in Marine Fish

List of mouse-specific primers used for qRT-PCR analysis. | Download Table
List of mouse-specific primers used for qRT-PCR analysis. | Download Table

Involvement of MicroRNAs in Regulation of Osteoblastic Differentiation in Mouse Induced Pluripotent Stem Cells | PLOS ONE
Involvement of MicroRNAs in Regulation of Osteoblastic Differentiation in Mouse Induced Pluripotent Stem Cells | PLOS ONE

View Image
View Image

Time for rethinking the different β‐actin transgenic mouse models? - Vanslembrouck - 2020 - Cytoskeleton - Wiley Online Library
Time for rethinking the different β‐actin transgenic mouse models? - Vanslembrouck - 2020 - Cytoskeleton - Wiley Online Library

Frontiers | β-Actin: Not a Suitable Internal Control of Hepatic Fibrosis Caused by Schistosoma japonicum
Frontiers | β-Actin: Not a Suitable Internal Control of Hepatic Fibrosis Caused by Schistosoma japonicum

Selective measurement of α smooth muscle actin: why β-actin can not be used as a housekeeping gene when tissue fibrosis occurs | BMC Molecular Biology | Full Text
Selective measurement of α smooth muscle actin: why β-actin can not be used as a housekeeping gene when tissue fibrosis occurs | BMC Molecular Biology | Full Text

Time for rethinking the different β‐actin transgenic mouse models? - Vanslembrouck - 2020 - Cytoskeleton - Wiley Online Library
Time for rethinking the different β‐actin transgenic mouse models? - Vanslembrouck - 2020 - Cytoskeleton - Wiley Online Library

β-actin dependent chromatin remodeling mediates compartment level changes in 3D genome architecture | Nature Communications
β-actin dependent chromatin remodeling mediates compartment level changes in 3D genome architecture | Nature Communications

Supplementary Table 1. List of primers used in this study Gene Forward primer Reverse primer Rat Met Rat Runx1 Rat Actin Mouse A
Supplementary Table 1. List of primers used in this study Gene Forward primer Reverse primer Rat Met Rat Runx1 Rat Actin Mouse A

Reference genes for gene expression studies in the mouse heart | Scientific Reports
Reference genes for gene expression studies in the mouse heart | Scientific Reports

Identification of the full-length β-actin sequence and expression profiles in the tree shrew (Tupaia belangeri)
Identification of the full-length β-actin sequence and expression profiles in the tree shrew (Tupaia belangeri)

MOUSE BETA-ACTIN, RNA / 395 bp (2 nmole)
MOUSE BETA-ACTIN, RNA / 395 bp (2 nmole)

Frontiers | β-Actin: Not a Suitable Internal Control of Hepatic Fibrosis Caused by Schistosoma japonicum
Frontiers | β-Actin: Not a Suitable Internal Control of Hepatic Fibrosis Caused by Schistosoma japonicum

Silencing of the Mouse H-rev107 Gene Encoding a Class II Tumor Suppressor by CpG Methylation* - Journal of Biological Chemistry
Silencing of the Mouse H-rev107 Gene Encoding a Class II Tumor Suppressor by CpG Methylation* - Journal of Biological Chemistry

MonoRab™ Beta Actin Antibody, mAb, Rabbit - GenScript
MonoRab™ Beta Actin Antibody, mAb, Rabbit - GenScript

PCR primer sequences for mouse Ube2d family members, p53 and β-actin | Download Table
PCR primer sequences for mouse Ube2d family members, p53 and β-actin | Download Table

Frontiers | Raptor/mTORC1 Acts as a Modulatory Center to Regulate Anti-bacterial Immune Response in Rockfish
Frontiers | Raptor/mTORC1 Acts as a Modulatory Center to Regulate Anti-bacterial Immune Response in Rockfish

Mouse ACTB (Actin, Beta) Endogenous Control (FAM™ Dye/MGB probe, Non-Primer Limited)
Mouse ACTB (Actin, Beta) Endogenous Control (FAM™ Dye/MGB probe, Non-Primer Limited)

Actb Mouse qPCR Primer Pair (NM_007393) – MP200232 | OriGene
Actb Mouse qPCR Primer Pair (NM_007393) – MP200232 | OriGene

Table S1. Sequence of primers used in real-time PCR Forward Primer Reverse Primer Human IL1β AGCTACGAATCTCCGACCAC CGTTATCCCATG
Table S1. Sequence of primers used in real-time PCR Forward Primer Reverse Primer Human IL1β AGCTACGAATCTCCGACCAC CGTTATCCCATG

β-Actin and GAPDH housekeeping gene expression in asthmatic airways is variable and not suitable for normalising mRNA levels | Thorax
β-Actin and GAPDH housekeeping gene expression in asthmatic airways is variable and not suitable for normalising mRNA levels | Thorax

Primers used for PCRof mouse and human integrin subunits. | Download Scientific Diagram
Primers used for PCRof mouse and human integrin subunits. | Download Scientific Diagram